EST details — SGN-E345387

Search information 
Request: 345387Match: SGN-E345387
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C140845Clone name: cTOF-13-I6
cartOrder Clone
Library Name: cTOFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E345387Length: 464 bp (921 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E345387 [] (trimmed) GGTGATGACAAACTTCACTGGAACTGGTATCGGTGTTGGTGCTGGCATTGGTTGCGGATTCGGTGTAGGATGGGGTTTCGGAGGCATGCCTTTGA
ATTTCTTGGGTCTTGGTGTAGGTGGTGGCTGTGGGATCGGAGTAGGCCTCGGATGGGGATTTGGCTCTGCCTTTGGTAGCCAGTACAGGAACTCT
AGAGTTACATTTGACGGCACAGATTTTATCAATAAGGAGCGTAGTGAAGAAAGAGATTTAAAAGATCCAGCCAAAGGCACTGGAAAAGCTCTTTC
TTCTCAGTAAATATACACATCTTCTGTTGATGCACTCATATTCTCACTTTCCAAAATTTGTTAAAGTTGTACAACCAGTTCCATTTCAGCTATCA
CTTGGAAACATATGTAGTATCATTTGACACTTGACAGTACTCTCTTCTTTGATGTCTAAAATTTGTTTACTTATGATGCTTGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E345387] SGN-U602593 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T156263 [Download][View] Facility Assigned ID: TOFBX51THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5