EST details — SGN-E355278
| Search information |
| Request: 355278 | Match: SGN-E355278 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C162368 | Clone name: cTOS-18-H12 |
| ||
| Library Name: cTOS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: suspension cultures
Development Stage:
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E355278 | Length: 253 bp (884 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E355278 [] (trimmed)
TTTCACAGTTAAAAAAACAAACACTCTTCCATCATAAAAAAGATATACTGAATATACATTATTCTCAACAAAAGAAAAACAACCACAATTACACT
TGTAATTATCAAATCCCGTGATCATTAGAGGTAGCAATAACACACAAATTATATTTTCTACTACAACTAGAACCAGGAGTTTCAGTAACATCAAC
ATCTTCAGGCTTCATCCCGTTAGGCAGCTTCCAATTGAAATGGTAAAAAAGTTGAGCTAATGG
TGTAATTATCAAATCCCGTGATCATTAGAGGTAGCAATAACACACAAATTATATTTTCTACTACAACTAGAACCAGGAGTTTCAGTAACATCAAC
ATCTTCAGGCTTCATCCCGTTAGGCAGCTTCCAATTGAAATGGTAAAAAAGTTGAGCTAATGG
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E355278] | SGN-U600117 | Tomato 200607 | Build 2 | 1 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T167463 [Download][View] | Facility Assigned ID: TSCCT42TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.904 | Expected Error Rate: 0.0103 | Quality Trim Threshold: 12.5 |
Working
