EST details — SGN-E358397

Search information 
Request: 358397Match: SGN-E358397
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C103067Clone name: cLHT-35-K14
cartOrder Clone
Library Name: cLHTOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E358397Length: 465 bp (1018 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E358397 [] (trimmed) TACAATTTTCACTTCTTCTCTCTTTTGTTGAACCAGAGTGCATCTTCTCAACAATGGCGCAAATTCCTCATATAGCAATTTTACCTTCTCCTGGT
ATGGGTCATTTAATCCCTCTTGTCGAATTTGCTAAGAGAATTTTTCTCCATCATCACTTTTCTGTTTCTCTGATTCTCCCTACTGATGGCCCAAT
TTCTAACGCTCAGAAAATTTTTCTGAACTCGCTTCCTTCTTCCATGGATTATCATCTTCTTCCTCCTGTTAATTTCGATGATTTACCTGAAGATG
CTAAAATCGAAACTCGTATTTCACTTACTGTGTCTCGTTCTCTTACTACACTGCGTCAAGTTTTGGAATCTATTATTGAGTCTAAGAAAACAGTT
GCCCTTGGAGCAGATTTGTTCGGTACTGATGCATTTGATGTAGCTATTCATATGAAAATTGCTTCCTATATTCTTTTCCCTTCTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E358397] SGN-U589051 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T172043 [Download][View] Facility Assigned ID: THTFH67TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.938 Expected Error Rate: 0.0277 Quality Trim Threshold: 14.5