Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E359228

Search information 
Request: 359228Match: SGN-E359228
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C100884Clone name: cLHT-11-D18
cartOrder Clone
Library Name: cLHTOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C193740 [TUS-69-A2] Trace: SGN-T346785 EST: SGN-E545910 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C193740 [TUS-69-A2] Trace: SGN-T346786 EST: SGN-E545911 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E359228Length: 502 bp (930 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E359228 [] (trimmed) TTTCTAGTTCCAATTCTTAGCTATGGGTGGTGATCACAAAGAGAAGACCACTGTAATGGTGCTAAAGGTTGATCTTCAGTGTCCCTGCTGCTACA
AGAAGGCCAAGAAAATTCTCTGCAAAATGCCTCAGGTTCGAGATCAGATGTATGATGAGAAGGCCAATACTATCACCATCCTTGTAGTTTGTTGT
AGTCCTGAACGGATTCGTGACAAATTGTGTTGTAAAGGAGGAAAAGCAATCAAAAGCATTGAGATCAAAGAGTTCCCAAAGGCTCCTGAAAAGCC
CGAAAAGCCCAAAGAACCAGAGAAGAAACCTAAGGTTGTCACTTTTGAAACGCCCAAGGAGCCCGAAAAGCCCAAGGAAAAAGTAAAGGAGCCCG
AAAAGCCCAAAGAAAAAGCAAAGGAGCCCGAAAAGCCCAAGGACAAAACCAAAGAGCCCGAAAAGCCCAAAGGACAAGAAAAACCCACTGTAATC
GAAAAGCCCAAGGACAAATCAAAAGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E359228] SGN-U591492 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T171430 [Download][View] Facility Assigned ID: THTBR21TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.934 Expected Error Rate: 0.0058 Quality Trim Threshold: 14.5