Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E359291

Search information 
Request: 359291Match: SGN-E359291
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C102668Clone name: cLHT-31-E10
cartOrder Clone
Library Name: cLHTOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C194097 [TUS-69-O23] Trace: SGN-T347398 EST: SGN-E546523 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C194097 [TUS-69-O23] Trace: SGN-T347399 EST: SGN-E546524 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E359291Length: 658 bp (895 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E359291 [] (trimmed) ATCTTTCTACTTGTTACTAAACAATTATCAAAATACACATATGGATAACTCATCGACTGATCTAAATAGAGCAATAGAAGGTTTAATTCGTGGTC
GAGAATTTACTCGACGACTAAAAGAGATTATTAAAAAATCTGGTGGTGAAGTTGAAAACATTATGGCTGAGGATTTAGTTGCCAAAATTCTGGAT
TCATTTTCTGAGACTCTCTCCGTTATAAACAATTCTGATGTCGTCGTCGCTACGGCGGTTGAGGTCAAGTCGCCGGAAGATTATTCTAGTGGAAG
TTGCAAGAGTTCAGATCGAAGAGGATGCTACAAGAGAAGGTGATTCATTAATTTCATTACTTACTAATTTTTCATGGAGGTTATTTTAGTCTTTG
TCACGTTTGTGGTCACAAGTTTTGATTGGTAATTGGTTCGTTCTCTTTTAGTTTAATAATTATTGCCAAGTTTGGTTGGTCGTTGATTGGTTATT
GACAATTTTGTCCTTCAACAAATGGTTGAAGTACTTTTTTGTTGGTTGGTCCCTACAAAGAATTGGTGATAATTAGATTGATTAAGATTTGTTCA
TACTAAATTCATGATGAGGGCCTTGGGGTTATCTATTTCTTACATAGTTAATTGTACTACTCATTAAATTACAATAATCATAGAGCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E359291] SGN-U577934 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T171677 [Download][View] Facility Assigned ID: THTER29TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.947 Expected Error Rate: 0.0160 Quality Trim Threshold: 14.5