EST details — SGN-E360522
| Search information |
| Request: 360522 | Match: SGN-E360522 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C108255 | Clone name: cLPP-8-F7 |
| ||
| Library Name: cLPP | Organism: Solanum pennellii (formerly Lycopersicon pennellii) |
Tissue: pollen
Development Stage: pollen collected from open flowers
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C194466 [TUS-70-O8] | Trace: SGN-T348032 | EST: SGN-E547157 | Direction: 3' | Facility: INRA (MWG) |
| Clone: SGN-C194466 [TUS-70-O8] | Trace: SGN-T348033 | EST: SGN-E547158 | Direction: 5' | Facility: INRA (MWG) |
| Sequence |
| Sequence Id: SGN-E360522 | Length: 165 bp (1010 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E360522 [] (trimmed)
AATAGCAACGGCTGTATTGATGGGATGGCTGCATTTCATTCTACAACAAGTGTTCATGAGCTTCTTGAATGCCCTGCTGGTACAAATCCTATGTA
CCCTCCAATCCATCAGTGTCACAATGGACACACAATCTGTTCCTCATGTTAAGCGAGGGCTCACAACCGA
CCCTCCAATCCATCAGTGTCACAATGGACACACAATCTGTTCCTCATGTTAAGCGAGGGCTCACAACCGA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E360522] | SGN-U586813 | Tomato 200607 | Build 2 | 1 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T172398 [Download][View] | Facility Assigned ID: TPOBE28TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.977 | Expected Error Rate: 0.0229 | Quality Trim Threshold: 14.5 |
Working
