Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E362869

Search information 
Request: 362869Match: SGN-E362869
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C106441Clone name: cLPP-2-D2
cartOrder Clone
Library Name: cLPPOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: pollen
Development Stage: pollen collected from open flowers

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180176 [TUS-33-K22] Trace: SGN-T186598 EST: SGN-E373633 Direction: 3' Facility: INRA
Clone: SGN-C180176 [TUS-33-K22] Trace: SGN-T186599 EST: SGN-E373634 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E362869Length: 416 bp (892 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E362869 [] (trimmed) GAGAACTAGTCTTGAGTTTCATTTCAATCTTGCTTGGTCGATTCTTTTTTCTTTTTGAAAAAAAAAATATTGTACACTACTTACCAAATATTCTG
TGGGCACCAACAGTTTATTCCCCTCCCCCAAAAGATTAAACAATGGCAGATGGTGAGGATATTCAACCACTGGTATGTGATAATGGAACAGGAAT
GGTGAAGGCTGGATTTGCTGGAGACGATGCGCCACTAGCAGTGTTTCCTAGCATAGTTGGTAGACCACGCCACACCGGTGCTTTGGCATGGATAT
GCCATAAAGATGCGTATGTTGGTGATGAAGCTCAATCGAAACGTGGGATTCTATCTTTGAAATATCCAATTGAGCATGGGATTGTGAGTAATTGG
GATGATATGGAGAAAATATGGCCTCATACATTTTAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E362869] SGN-U581585 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T173729 [Download][View] Facility Assigned ID: TPOAH13TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0205 Quality Trim Threshold: 14.5