EST details — SGN-E365953

Search information 
Request: 365953Match: SGN-E365953
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C108819Clone name: cLPT-11-C8
cartOrder Clone
Library Name: cLPTOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E365953Length: 352 bp (1114 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E365953 [] (trimmed) CAGAGTGAAGTAGGCTGAAACGACAACAATGGCGACGGAAGGAACAAAAGTGGGAAGAATGAAATTGGGTTCAGAGGGGCTTCAAGTATCTGCTC
AAGGACTTGGTTGTATGGGTATGTCCGCTTTTTACGGGCCGCCCAAACCCGAACCCGATATGATCGAACTAATCCACCACGCCATTAACTCCGGC
GTCACTCTTCTCGATACCTCCGATGTATATGGGCCTTACACCAATGAAATCCTCATTGGTAAAGCTTTGAAGGGAGGGATGAGAGAACGGGTTGT
ATTAGCAACAAAGTTTGGTATTGTTTTAGGAGATGAAAAGAAAGCAGAAGGAAAGAGAGAAGTGCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E365953] SGN-U595439 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T179526 [Download][View] Facility Assigned ID: TPTBP16TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.982 Expected Error Rate: 0.0168 Quality Trim Threshold: 14.5