EST details — SGN-E368596

Search information 
Request: 368596Match: SGN-E368596
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C176310Clone name: TUS-23-J20
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C176310 is on microarray TOM1 spot ID 1-1-5.2.10.5 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C26417 [cLEF-40-F14] Trace: SGN-T60052 EST: SGN-E246200 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E368596Length: 291 bp (909 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E368596 [] (trimmed) AAGAGTGGAGTTCCCATGCTGGAAACTGTTGGATTGGGGGACCATGCGCTTATTAATACATGTGGTAACTATTTACATGATCTAGGCACTTTCAG
TGAAGATACAAATATGGACTCTGATAGATAGGCTATTATGATGGCTTGGGAGAAGCCATTGATGGAAGCTCATGCGAAAGCTGTATGCTCAAATG
GTGGTCACATACTGAACATTGGATTTGGGATGGGCCTTGTAGATACAGCCATACAACAATATTCACCTTTATCACACACTATTATTGAAGCTCAT
CCAGTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E368596] SGN-U589445 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T181523 [Download][View] Facility Assigned ID: FA0AAD11DE10RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.946 Expected Error Rate: 0.0137 Quality Trim Threshold: 14.5