EST details — SGN-E371776

Search information 
Request: 371776Match: SGN-E371776
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179099Clone name: TUS-30-O1
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179099 is on microarray TOM1 spot ID 1-1-8.3.3.19 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C78803 [cLES-6-M8] Trace: SGN-T98448 EST: SGN-E286996 Direction: 5' Facility: TIGR
Clone: SGN-C179099 [TUS-30-O1] Trace: SGN-T184391 EST: SGN-E371777 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E371776Length: 318 bp (903 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E371776 [] (trimmed) GTTACTTGATTTTGCGTGAATAATTCATACATGCACAAAATATACAAATAATTACCTTACTCATAAGTCAATAAAATACAAAAATAAAATTAAAA
AAATGTCACCTATTTTTTGTTCTTTCTTCTAGAATAAACCATACCTCGGATCCCATCCGGGTCAGCAACAAAACCCAAAGGCCTATAGAACCCGA
AAACTCGGGGCTCCGAATAAAGAGCAATATTCGTAATCCCTTTGCGTAACAGTTTGGTGACTAATTTTTTCATCACAGCTTTTCCCAATTCAATC
CCTTGGAAATTTGGATCCACCACAACATTCCAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E371776] SGN-U589747 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T184390 [Download][View] Facility Assigned ID: FA0AAD18AH01FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.891 Expected Error Rate: 0.0046 Quality Trim Threshold: 14.5