EST details — SGN-E374090
| Search information |
| Request: 374090 | Match: SGN-E374090 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C179987 | Clone name: TUS-33-D1 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C87116 [cLET-45-F24] | Trace: SGN-T111666 | EST: SGN-E300494 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C179987 [TUS-33-D1] | Trace: SGN-T186705 | EST: SGN-E374091 | Direction: 5' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E374090 | Length: 238 bp (912 bp untrimmed) |
| Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E374090 [] (trimmed)
AACAACTTCACAAATACAAATTCCGCATTTCATTACCATGACATACATATGGTTCATACAAAAACGATGAAAGAAAGGTACTACTAGCAATAATA
ATACTGGAGGAAGTAGTCCACTAGCTGTACGGGAGCCTCAAATGTGTCATGATGATACATTATTTTTCACTATCTACTTGTGTTTTGGGTCAAAA
AATTACTTTTGCTTAACTAAAAAACGTCATACCCACTAACGTGCAAGT
ATACTGGAGGAAGTAGTCCACTAGCTGTACGGGAGCCTCAAATGTGTCATGATGATACATTATTTTTCACTATCTACTTGTGTTTTGGGTCAAAA
AATTACTTTTGCTTAACTAAAAAACGTCATACCCACTAACGTGCAAGT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E374090] | SGN-U594274 | Tomato 200607 | Build 2 | 1 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T186704 [Download][View] | Facility Assigned ID: FA0AAD21CB01FM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.924 | Expected Error Rate: 0.0090 | Quality Trim Threshold: 12.5 |
Working
