EST details — SGN-E376798

Search information 
Request: 376798Match: SGN-E376798
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C174583Clone name: TUS-19-B21
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C174583 is on microarray TOM1 spot ID 1-1-4.2.15.12 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C23254 [cLED-4-O21] Trace: SGN-T49422 EST: SGN-E231653 Direction: 5' Facility: TIGR
Clone: SGN-C174583 [TUS-19-B21] Trace: SGN-T189413 EST: SGN-E376799 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E376798Length: 363 bp (873 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E376798 [] (trimmed) ACACACTGTGGATGGAACTCGATCTTAGAAGGGATATCGGTTGGTGTCCCAATGATCACTTGGCCATTATTTTCTGAACAATTTTGTAATGAGAA
GCTTATTGTGAATGTACTCAAGACAGGAGTGAAGGGTGGTATGGAGAATCCAGTGATGTTTTTAGAGGATGAAAAAGGATGTGCACAAGTGAAGA
AAGATGATATTAAGATGGTTATTGAAAGATTAATGGGTGAAGAAGAGGAAGCAAAAATGAGAAGAGAAAGAGCTAAAGGGCTTGCAGATATGGCA
ACAAAGGCTGTGGAGGAAGGAGGTTTATCTCACATTAATTTGACAAAACTAATAGAATATGTTATACATCAACCAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E376798] SGN-U580322 Tomato 200607 Build 2 38 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T189412 [Download][View] Facility Assigned ID: FA0AAD7CA11FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.947 Expected Error Rate: 0.0273 Quality Trim Threshold: 14.5