EST details — SGN-E377589

Search information 
Request: 377589Match: SGN-E377589
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C175255Clone name: TUS-20-N21
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C175255 is on microarray TOM1 spot ID 1-1-4.2.13.9 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C24180 [cLED-7-H10] Trace: SGN-T50618 EST: SGN-E232109 Direction: 5' Facility: TIGR
Clone: SGN-C175255 [TUS-20-N21] Trace: SGN-T190089 EST: SGN-E377590 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E377589Length: 498 bp (900 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E377589 [] (trimmed) AAGGAACAAATTATTTTCATTCACATATTCAAACAAAACTAAATCATACATCCAATATCTTCTCTTCTTCTTTTTTTTTTTTCAACTAAAACCAA
ATATTGTACAAATAAAACACCTACTTCTTCACATACCTCTAAATTAACCACCCAAAAAAAAAAAACTAAAAGGGTATACATATATATGTATTACA
ATCTTAACAACTTATATTGGTTACTAGTTAAGTCAATGTCTTATAAAACTAAACAATAATATATTAATTTTTGATGTTAGTAGGTGAAGTTTTTC
ACATAGCAATTTGTTTTTGAGTAGCACATTGAGCATTGTCTTGGACAAGTGATAATATGGTCATTGGTAAGCCCAACTGCCTGCATAAAAAAATG
TATAATTGTTGGGCCAACATATCTAAACCCTTTTTTCACCATATCTTTGCTCATTGGTTCTGATTTTGAAGGCCTTACCGGGATTTTGGTGCAAG
CCTTGGATTGGGTTCTAATGGGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E377589] SGN-U599235 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T190088 [Download][View] Facility Assigned ID: FA0AAD8CG11FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.857 Expected Error Rate: 0.0070 Quality Trim Threshold: 14.5