EST details — SGN-E379086
Search information |
Request: 379086 | Match: SGN-E379086 |
Request From: web user | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C167660 | Clone name: TUS-1-B10 |
| ||
Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
Clone: SGN-C1408 [cLEC-12-A21] | Trace: SGN-T25828 | EST: SGN-E200243 | Direction: 5' | Facility: TIGR |
Clone: SGN-C167660 [TUS-1-B10] | Trace: SGN-T1122 | EST: SGN-E379831 | Direction: 5' | Facility: Avesthagen |
Sequence |
Sequence Id: SGN-E379086 | Length: 228 bp (817 bp untrimmed) |
Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E379086 [] (trimmed)
TTATATTGTTATGGTGGTTCTAGATTACTAGGTCGATGAGAACATTGAGTCACTGCTCTGGAGTTTTTGGCAATTGCAGGGCAAGTTCCTTTGCA
GTTTTTTTCTTCTTCATATTTTAGGTTTATAAAAATCCAAATTGGTTAAGCTAATGTTTTTTGTCTTGGCTAGGCACAGTGGTATTTTTGTTGCA
ATGTAATGTCATGGCTGTAATCTTTATTTAGTGTCAAT
GTTTTTTTCTTCTTCATATTTTAGGTTTATAAAAATCCAAATTGGTTAAGCTAATGTTTTTTGTCTTGGCTAGGCACAGTGGTATTTTTGTTGCA
ATGTAATGTCATGGCTGTAATCTTTATTTAGTGTCAAT
Unigenes |
Current Unigene builds | |||||
[SGN-E379086] | SGN-U593021 | Tomato 200607 | Build 2 | 1 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T180 [Download][View] | Facility Assigned ID: 227_B10_TUS01B10.Td_079.ab1 |
Submitter: Koni | Sequencing Facility: Avesthagen |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.914 | Expected Error Rate: 0.0235 | Quality Trim Threshold: 14.5 |