Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E379086

Search information 
Request: 379086Match: SGN-E379086
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C167660Clone name: TUS-1-B10
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C1408 [cLEC-12-A21] Trace: SGN-T25828 EST: SGN-E200243 Direction: 5' Facility: TIGR
Clone: SGN-C167660 [TUS-1-B10] Trace: SGN-T1122 EST: SGN-E379831 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E379086Length: 228 bp (817 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E379086 [] (trimmed) TTATATTGTTATGGTGGTTCTAGATTACTAGGTCGATGAGAACATTGAGTCACTGCTCTGGAGTTTTTGGCAATTGCAGGGCAAGTTCCTTTGCA
GTTTTTTTCTTCTTCATATTTTAGGTTTATAAAAATCCAAATTGGTTAAGCTAATGTTTTTTGTCTTGGCTAGGCACAGTGGTATTTTTGTTGCA
ATGTAATGTCATGGCTGTAATCTTTATTTAGTGTCAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E379086] SGN-U593021 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T180 [Download][View] Facility Assigned ID: 227_B10_TUS01B10.Td_079.ab1
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.914 Expected Error Rate: 0.0235 Quality Trim Threshold: 14.5