EST details — SGN-E391261

Search information 
Request: 391261Match: SGN-E391261
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185485Clone name: TUS-47-I3
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185485 is on microarray TOM1 spot ID 1-1-6.1.10.21 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C78955 [cLES-7-F14] Trace: SGN-T98950 EST: SGN-E288194 Direction: 5' Facility: TIGR
Clone: SGN-C185485 [TUS-47-I3] Trace: SGN-T192073 EST: SGN-E390747 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E391261Length: 235 bp (874 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E391261 [] (trimmed) GAACCCATAGATCTTATTATTTATTTTTGTGAAATTTTAACAACCCTCAAAAAAGCTTCATTACAATATCTCAGCAAATGTTAGTCTAAAAAGTG
AATTCAAAATCACCTTCAAGTTTCCATGAATTTCCTCTTCATCGCATAATTTCGTGTACTCTTTTGCCCCCATCAAAGATTCGAGCTCCGATGGA
TTGTTCGGCTTCACTTTGAAGATCCGTCCGTCTTAATTAAGGCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E391261] SGN-U593160 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T192587 [Download][View] Facility Assigned ID: FA0AAD35AE02FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.880 Expected Error Rate: 0.0166 Quality Trim Threshold: 14.5