EST details — SGN-E391292

Search information 
Request: 391292Match: SGN-E391292
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185509Clone name: TUS-47-J3
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185509 is on microarray TOM1 spot ID 1-1-6.2.10.21 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C79568 [cLES-9-G23] Trace: SGN-T99443 EST: SGN-E287624 Direction: 5' Facility: TIGR
Clone: SGN-C185509 [TUS-47-J3] Trace: SGN-T192344 EST: SGN-E391018 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E391292Length: 462 bp (839 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E391292 [] (trimmed) GAAACTTTTTTCTTATTATTTATTTTTGTGAAATTTTAACAAGTTTTTTTAAAGTTTCATTACAATATCTCAACAAATGTTAGTCTAATAAGTGA
ATTCAAAATCGCCTTCCTGTTTCTTTGAATTTCCTCTTCATCGCATAATTTCGTGTACTCTTTTGCCCCCATCATATATTCGAGCTCTGATGGAT
TGCTCGGCTTCACTTTGATCATCCATCCGTCTTCATAAGGGCTCGAGTTGATCAAACCATGTGTTTCACTGAGCTTTGAGTTGACCTCAACGATC
TCGCCTGATATCGGAGAGTTAATGTCACTGGTGGCTTTCACACTTTCAACAGCTCCAAAGCTACTTCCATGTGAAACAGAAGCACCACTATCTGG
AAAATCTACAAACACCTCTTCTCCCAAATGATCCTGAGCATGGGCAGTTATTCCAATTGTTGCCACTGACCCCTCATGCTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E391292] SGN-U577279 Tomato 200607 Build 2 42 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T192618 [Download][View] Facility Assigned ID: FA0AAD35CE02FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.931 Expected Error Rate: 0.0200 Quality Trim Threshold: 20.5