EST details — SGN-E392724
Search information |
Request: 392724 | Match: SGN-E392724 |
Request From: web user | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C181639 | Clone name: TUS-37-H21 |
| ||
Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C181639 is on microarray TOM1 spot ID 1-1-4.4.12.10 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
Clone: SGN-C145773 [cTOF-2-M23] | Trace: SGN-T152896 | EST: SGN-E340166 | Direction: 5' | Facility: TIGR |
Clone: SGN-C181639 [TUS-37-H21] | Trace: SGN-T194240 | EST: SGN-E392914 | Direction: 3' | Facility: INRA |
Sequence |
Sequence Id: SGN-E392724 | Length: 160 bp (822 bp untrimmed) |
Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E392724 [] (trimmed)
CTTTCTCAGATAATGATGATATTCTTAGTGTGTGAAGTCGATTCTTGCTTGACTTCTGGGCTCACCCGAGGCGAGGACTGCTTTCTTTCTTGCTT
TGTATCGAGGGTATGTGTATGCGGTTGTAGTACATCTTCATTATTGATAAATGTTTCCTTCTCTT
TGTATCGAGGGTATGTGTATGCGGTTGTAGTACATCTTCATTATTGATAAATGTTTCCTTCTCTT
Unigenes |
Current Unigene builds | |||||
[SGN-E392724] | SGN-U562809 | Tomato 200607 | Build 2 | 7 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T194050 [Download][View] | Facility Assigned ID: FA0AAD25CD11RM1 |
Submitter: Koni | Sequencing Facility: INRA |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.947 | Expected Error Rate: 0.0319 | Quality Trim Threshold: 14.5 |