Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E393410

Search information 
Request: 393410Match: SGN-E393410
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C182203Clone name: TUS-38-P9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182203 is on microarray TOM1 spot ID 1-1-8.4.10.14 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C81404 [cLET-16-D8] Trace: SGN-T106629 EST: SGN-E292496 Direction: 5' Facility: TIGR
Clone: SGN-C182203 [TUS-38-P9] Trace: SGN-T199333 EST: SGN-E398007 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E393410Length: 342 bp (868 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E393410 [] (trimmed) CTCTACAAAACAACAACCAAATGAAAACTTTATTGATTGCCCCTAACAATGTCATGTAAACAACCATGTCATTTTACAAAAACAGTAGTACTATG
ATTTTAAAATCAGGGGTGCCCAATCTATATCCAAGCTGGATTCTTCAATGGAGTAACAACAGCCTTCACTTGTAAGTATTTGTTAAGGCTGTAAA
TACCCTTTTCCCTGCCCATGCCACTCATCTTGTACCCTCCAAAAGGAATTCCAGCATCAAATATATCTTATCATTTAACCCACTTCGTTCAAACT
CTCAATCCTCGGGTCAGGGTGTTTGTTATTGTCCATGAGGGGTGGAAATTTTTTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E393410] SGN-U587984 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T194736 [Download][View] Facility Assigned ID: FA0AAD26CH05FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.937 Expected Error Rate: 0.0182 Quality Trim Threshold: 14.5