EST details — SGN-E394180

Search information 
Request: 394180Match: SGN-E394180
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183719Clone name: TUS-42-O13
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183719 is on microarray TOM1 spot ID 1-1-4.3.1.5 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C32414 [cLEG-1-G11] Trace: SGN-T64368 EST: SGN-E248305 Direction: 5' Facility: TIGR
Clone: SGN-C183719 [TUS-42-O13] Trace: SGN-T194968 EST: SGN-E393642 Direction: 3' Facility: INRA
Clone: SGN-C183719 [TUS-42-O13] Trace: SGN-T194968 EST: SGN-E399203 Direction: 3' Facility: INRA
Clone: SGN-C183719 [TUS-42-O13] Trace: SGN-T194969 EST: SGN-E393643 Direction: 5' Facility: INRA
Clone: SGN-C183719 [TUS-42-O13] Trace: SGN-T195507 EST: SGN-E394181 Direction: 5' Facility: INRA
Clone: SGN-C183719 [TUS-42-O13] Trace: SGN-T195507 EST: SGN-E399204 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394180Length: 557 bp (841 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E394180 [] (trimmed) GTCAATAAGAATCAAAGTTGTGTTTCCCATATCTGACTTGTAATTTAAAGTAACACCCACCTGCATATTGAAGTTTTACAGTCACATGATGACTG
CCCTAATCCTTCCGCACTCCTTCCAAATTTAACAAAAAAGTAAACCATATCCGGAAACTCAAATCTATCACAAAAACGCCAAGCCTGTTTAGTAA
TAATCAAGCAAAACAAGTAAGCAAAGGGTTTTCTACCATAACTGATTCACAACAACCAGAGGAACGCCTCCGTGAACCTAAAGGTGCCACCTATT
CATGTCTATAACAACTTTTTGTCTTTCAGTGGACCTCTTGGAATTTTGCTTAAAACCTTGACCTTGAAAACAGCATACTGCTTTTTGATCTCTGC
CTCAGCCTTCTCAACAAAAGCATCAACCTGGTCCTCAAATTTCTCATAAAGTACAGGGACGGTATGGAGCCAATACAAAGCATATGTAAAACAGA
GTGAGGAAGTTCCAGCAGTTGCCCAATATTGAAAGAACCCCCCAACCAGCAATAACACCGAGGAATTTCCTCCACTCCTTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394180] SGN-U586311 Tomato 200607 Build 2 114 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195506 [Download][View] Facility Assigned ID: FA0AAD30AH07FM2
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.937 Expected Error Rate: 0.0157 Quality Trim Threshold: 20.5