EST details — SGN-E394501

Search information 
Request: 394501Match: SGN-E394501
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183016Clone name: TUS-41-B6
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183016 is on microarray TOM1 spot ID 1-1-3.2.3.4 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C16242 [cLED-15-L21] Trace: SGN-T52267 EST: SGN-E235694 Direction: 5' Facility: TIGR
Clone: SGN-C183016 [TUS-41-B6] Trace: SGN-T195828 EST: SGN-E394502 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394501Length: 331 bp (881 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E394501 [] (trimmed) AGCCTTTTTACGCGATATTGCATAGGATTGATGTGGGGATTGTGATTGATTTAGAGCCAGCTAGAACAGAGGACCCTGCATTGTCTATTGCTGGA
GCTGTGCAATCGCAGAAGCTAGCTGTGAGAGCTATTTCGCTTTTGCAATCGTTACCTGGTGGGGATATTGATCTTTTGTGTGATACTGTTGTTAA
GAGTGTCAGGGAGCTTACGGGGTATGATCGGGTGATGGTGTATAAGTTTCATGATGATGAGCATGGGGAGGTCGTGGCGGAGAGTAGAAGATCGG
ATTTGGAGCCTTATATTGGTTTGCATTATCCAGCTACTGATCCACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394501] SGN-U570094 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195827 [Download][View] Facility Assigned ID: FA0AAD29DA03FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.948 Expected Error Rate: 0.0019 Quality Trim Threshold: 14.5