EST details — SGN-E395809

Search information 
Request: 395809Match: SGN-E395809
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C174511Clone name: TUS-18-O21
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C174511 is on microarray TOM1 spot ID 1-1-4.3.15.3 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C23144 [cLED-4-J5] Trace: SGN-T49304 EST: SGN-E231535 Direction: 5' Facility: TIGR
Clone: SGN-C174511 [TUS-18-O21] Trace: SGN-T197136 EST: SGN-E395810 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E395809Length: 232 bp (860 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E395809 [] (trimmed) AATGACCCTTTTGTATTATATTGAATCTTGAACGGAAAAAGGAGAGCCTTTTATCAGAGTTATATTTACAATACATATATCAGGTATAAACTGCA
ATATCAAAAAAGCTGTGGGACACTTCTCTTCTATGCTGTAACAGAACTCAATATTATACAGAGGACAAATAAAAGCCTCAAGAAGAAATAATAAT
CAAATAATAGTTGAAAAAGGAATAATATAGCCATAATAACTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E395809] SGN-U596596 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T197135 [Download][View] Facility Assigned ID: FA0AAD6AH11FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.923 Expected Error Rate: 0.0197 Quality Trim Threshold: 14.5