EST details — SGN-E396519

Search information 
Request: 396519Match: SGN-E396519
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C176654Clone name: TUS-24-I4
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C176654 is on microarray TOM1 spot ID 1-1-5.1.9.12 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C27194 [cLEF-42-N14] Trace: SGN-T60683 EST: SGN-E247639 Direction: 5' Facility: TIGR
Clone: SGN-C176654 [TUS-24-I4] Trace: SGN-T193329 EST: SGN-E392003 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E396519Length: 374 bp (836 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E396519 [] (trimmed) TTGTAAGTTTGATAAACGTCTAGTCTAGATAGAAATGGCAAATCCAAAGGTTTTCTTTGACCTTACCATCGGTGGTGCACCAACTGGTCCTGTGG
AGATGGAGCTCTTCCCCGATACCACACCATAAACCGCTGACAACTTCCGAGCTCTTTGTACCGGTGAGAAAGGTGTTGGAAAGATGGGAAATCCT
TTGCACTACAAGGGCTCAACCTTCCACCGTGTGATCCCATTGTTCATGTGTCTGGGAGGTGATTTCGCCACCGGAAACGGGACCGGAGGAGAGTC
GATCTATGGATCCAAATACGTCGATGATAACTTCGATAAAACTCACACCTGCCCTGCAATCCTCTCCACGGCTAACGCTGGACATGCAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E396519] SGN-U592255 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T197845 [Download][View] Facility Assigned ID: FA0AAD12BE02RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.985 Expected Error Rate: 0.0346 Quality Trim Threshold: 14.5