EST details — SGN-E399414

Search information 
Request: 399414Match: SGN-E399414
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183685Clone name: TUS-42-N3
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183685 is on microarray TOM1 spot ID 1-1-6.2.1.1 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C32399 [cLEG-1-E9] Trace: SGN-T64426 EST: SGN-E248363 Direction: 5' Facility: TIGR
Clone: SGN-C183685 [TUS-42-N3] Trace: SGN-T196101 EST: SGN-E394775 Direction: 3' Facility: INRA
Clone: SGN-C183685 [TUS-42-N3] Trace: SGN-T200382 EST: SGN-E399415 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E399414Length: 282 bp (1001 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E399414 [] (trimmed) CCAATAAAATTGAGTACTGAACTGTTAAAATAGTATTACAACAATAAATTTTTGGTGTCTGTTCTTGTTACATTACTCCCAAACAAAACTACTTC
AACATTGATCTTCAAAATAAATAATTACATTTTATACCATATTAATGAATAATCAAACATACAAAAACTTTAATCCAAACCCTTGAAACTTTTCT
TCAATGAAATAATTGATTTTATCCATCATCCCTACAGAAAAATAATTCTTCCAATCCCCAATTTCCCCCCTACAAAAAAACACTTTAAATGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E399414] SGN-U593911 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T196101 [Download][View] Facility Assigned ID: FA0AAD30CG02FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.841 Expected Error Rate: 0.0097 Quality Trim Threshold: 14.5