Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E402988

Search information 
Request: 402988Match: SGN-E402988
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C267122Clone name: PPC-9-E10
nocartOrdering Not Available
Library Name: PPCOrganism: Solanum tuberosum

Tissue: leaf
Development Stage: 6 week old

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E402988Length: 321 bp (948 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E402988 [] (trimmed) CGGAAGATTAGCTATGTTCTCCATGTTTGGATTCTTCGTTCAAGCTATTGTTACCGGCAAAGGCCCACTTGAGAACCTATTGGATCACCTTGACA
ACCCTGTTGCTAACAATGCATGGGTTTATGCAACTAAGTTTGTTCCTGGTTCTTAAATTTTTTACATTTTGACTTCCTCCATAAGAGGCTTTGTA
GTTTGTACCACTCAATCATTCATAATGCAAATATTTGGCAAAGGAAAATTATTTTNCNTNNNNAAAAAAAAAAAAAAAAAAAAAAAAAAAANAAA
AAAAAAAAAAAAAAAAAAATTTAAAAAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E402988] SGN-U287213 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T260559 [Download][View] Facility Assigned ID: PPCBH29TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.936 Expected Error Rate: 0.0340 Quality Trim Threshold: 12.5