EST details — SGN-E404037

Search information 
Request: 404037Match: SGN-E404037
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C263217Clone name: PPC-12-B9
nocartOrdering Not Available
Library Name: PPCOrganism: Solanum tuberosum

Tissue: leaf
Development Stage: 6 week old

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E404037Length: 256 bp (923 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E404037 [] (trimmed) CACCGCTTCATACGCTCCAAAAATGCTAAAACAAAACACCCATTAAGCCAAAATCCCTCTTTCTTGTTTTTGTGTTAAAGAAAGAGAGTTGCAGA
ATCCCAAGTTTTCATCTTTACTAGTTTTCTCTTGTTGGTGGTAGGTTGTGAATTAGTGGTGTGGCTCCATCATCTTGTCAGTCAGTCGAAAAGTG
CTAATGCTGGAGTGAGATCTCCAGTAAAATCTCCAACCCGTTCACCTAATCAAAAGACAATTGAGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E404037] SGN-U292479 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T261608 [Download][View] Facility Assigned ID: PPCBU05TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0063 Quality Trim Threshold: 14.5