EST details — SGN-E406724
Search information |
Request: 406724 | Match: SGN-E406724 |
Request From: web user | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C260785 | Clone name: PPI-4-D8 |
| ||
Library Name: PPI | Organism: Solanum tuberosum |
Tissue: leaf
Development Stage: 6-week old leaf
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E406724 | Length: 232 bp (924 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E406724 [] (trimmed)
TCTTGCAACATTTGCAACTGCAATTTACAATCTTATCCCTTGCAATGACTTTTTGTTATTAGCAGTCCTTCTTAAGGTTTGAGAATCTATCATTT
GATAAAGTAAGTGGGAAAGCAAAGGTAATGGGAACAATGATATGTGTTGGTGGAGCAATGCTATTGACATATACAAAGAATAGAGGTTCATATGT
GGCCTATCAAAATGATTTGCTACATCATGATAATGAATCAAC
GATAAAGTAAGTGGGAAAGCAAAGGTAATGGGAACAATGATATGTGTTGGTGGAGCAATGCTATTGACATATACAAAGAATAGAGGTTCATATGT
GGCCTATCAAAATGATTTGCTACATCATGATAATGAATCAAC
Unigenes |
Current Unigene builds | |||||
[SGN-E406724] | SGN-U297788 | Solanum tuberosum | Build 4 | 1 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T253799 [Download][View] | Facility Assigned ID: PPIAP16TH |
Submitter: Koni | Sequencing Facility: TIGR |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.934 | Expected Error Rate: 0.0204 | Quality Trim Threshold: 20.5 |