EST details — SGN-E411681

Search information 
Request: 411681Match: SGN-E411681
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C267855Clone name: STM-15-G17
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E411681Length: 293 bp (1113 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E411681 [] (trimmed) ATATATTATATTAATATGTACGATAGACATTAGTGTGCCGTCGATTTGAACGATCTGCACATAGTAACTAACGTAATAGACGCAAAATAATATAG
TACATGTTGCAGCTGTGCTAAATAAGATTAGCATGTCATTGTTTATGACATATTTTGAGGCCAATGCAGTTTGCTTCTCCATAGCTAATGTGCCT
CATGCAAAAAACCAGAGCATAGGGAGAGTCAACCATTATGTTGTCCCTATTATAAGCAAAAGTGACAAAATGGGAGGGTTGAGTTCCTTTTACAC
CTTTTTGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E411681] SGN-U268142 Solanum tuberosum Build 4 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T263818 [Download][View] Facility Assigned ID: STMCE45TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0047 Quality Trim Threshold: 20.5