EST details — SGN-E415286

Search information 
Request: 415286Match: SGN-E415286
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C269922Clone name: STM-21-G5
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C269922 [STM-21-G5] Trace: SGN-T267422 EST: SGN-E415285 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E415286Length: 348 bp (911 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E415286 [] (trimmed) TTTTTTTTTTTTTTTTTTTTTTTTGATTCCACAACTTGAACTCGTGAAGACAACTTTATTGTTGCTACAAGGTTCACTTCATGTTACAACATGAT
AATGTCTCAAAAACATCAGACAAAAGAATAGAGACGTTTAGGCTACGATACAACACTCAGCAATTTTGAATCCTTCAAACAGTTGCATAAATGGC
AAAAATTATACCGACTGCAAATGCATCTGCCAAAAAGATCATTTGTTGAGGGCTCAAGGAAGCCTCCTCTTAAAAAAATTAAACAGCAGCAGGAG
TTTTGCTGTCGATAGACTTGAGCACTTCTTCACCCATTTCCTTGCATCCGACCAATTTATGTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E415286] SGN-U292446 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T267423 [Download][View] Facility Assigned ID: STMDC39TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.945 Expected Error Rate: 0.0099 Quality Trim Threshold: 14.5