EST details — SGN-E416396

Search information 
Request: 416396Match: SGN-E416396
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C270495Clone name: STM-23-C1
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C270495 [STM-23-C1] Trace: SGN-T268532 EST: SGN-E416395 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E416396Length: 419 bp (903 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E416396 [] (trimmed) TTTTTTTTTTGTGAGAGGTAACATACTGTACTCTTTGCTTTGAAACTTAGCCACTAAGGAAAGTTATTTGATATGACATTATGACAAGCAATTAG
CAAAAAGTTAAAAATGCAAGAATATGATCAATAGACGAACTTAAAAACTTCTCCAAGTAGATCTATAACCATAATAGTTGATATCCTTCGTAACT
TTACATCGAAAAAGTCCTCTTCCTCTTACCCTACCAGTAACCTCAAAATGGGGAAAAAGTAAACTATTAGTACTTACTACGAAATATAGTAAAGA
AGACTAATAAGCCTAATTTGTGAATACAAGAAAAAGATATAGTCGATAATAGAAATCAAAGATTCTTTGACCCACCAAATGCCCCATTCTCAAGT
GCCAACGACCATATCTTAGACCATAAAAATTAATATTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E416396] SGN-U271234 Solanum tuberosum Build 4 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T268533 [Download][View] Facility Assigned ID: STMDK13TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.927 Expected Error Rate: 0.0182 Quality Trim Threshold: 14.5