EST details — SGN-E417503

Search information 
Request: 417503Match: SGN-E417503
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C271146Clone name: STM-25-F15
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C271146 [STM-25-F15] Trace: SGN-T269639 EST: SGN-E417502 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E417503Length: 294 bp (898 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E417503 [] (trimmed) CAAAGAAATTCATCATTTCTAGCAGCACAGAGATCGATCAAAACAATAATGTCAGATCAACTGCACAAGGATTAAAACAATCCGCAAAATTTGCG
ATTGATGAAGCATAAATGAAAACTTTGGACATCTGATGCAAAAGGTTCAGACAAAAATCTTGTAATACTATCTGGGGTTTGTGTAGACCCTGTAT
CTACGTTTAAGGGATGAAACCTAATCCTTTACCTTTGTAGCATTTTCTAATTATCTACCCAACAACTCCTCCAACCATGTCATGCATGATACAAG
CTGCAAGCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E417503] SGN-U278947 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T269640 [Download][View] Facility Assigned ID: STMDU32TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.941 Expected Error Rate: 0.0106 Quality Trim Threshold: 20.5