Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E420764

Search information 
Request: 420764Match: SGN-E420764
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C272989Clone name: STM-31-B2
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E420764Length: 424 bp (970 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E420764 [] (trimmed) CAAAAACAAAAAATATATTCCACATTCTCCTTTTTTCTTCTTGTTCTAGTTTTGTGAGAATTAATTAGTAATATATAATGGCTTTAATTGAGAAT
TATACAGGTTTTGAAAGAGTGAAACATGTAGGAGCAATGACTTTGGCAGCAGTATTATTAGGAGGAAATATTGTATTGTCAAAAGTGGCAGCAGA
TGATGGAATGACTATGAGAGTTATGGTTGCTTATAGATGGATTTTTGCTACTGCATTTCTTGCTCCAATTGCTATTGTTGTTGAATGGAATAAGC
GGCCAAAACTAACTTGGACGGTTATTGTGCAAGCATTTCTCTCGGGACTACTAGGGGGTTCATTATTTTCGATTTTATTTTATACAAGTGTGATA
ATGACATCTGCAACATTTGCAACTGCAATTTACAATCTTATCCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E420764] SGN-U295591 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T272901 [Download][View] Facility Assigned ID: STMET01TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.938 Expected Error Rate: 0.0050 Quality Trim Threshold: 14.5