EST details — SGN-E421730

Search information 
Request: 421730Match: SGN-E421730
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C273841Clone name: STM-33-I6
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C273841 [STM-33-I6] Trace: SGN-T273866 EST: SGN-E421729 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E421730Length: 281 bp (942 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E421730 [] (trimmed) GCTATGAAAGCAGAGTTAAAGCGCTAAAATGTCAATATCCTCGTTGATTACAAAAAAAACAAGAAATCATTTGGACTTCCAATCTATTTCTACAG
AGAGCTCATAAAAGGGTCCAAAATGGTGAGCTAAACATGTACAAGTATACTCACAAAAGAAGGTAAACACAAGGTGACGCTAGCAAAATGGAAAC
AACAGCAACAACTACTAGCTCAATTAGACAGCAAAAAATTATGTATCTGTGTCATATCTTCTATCCTGTGCTATCCAATCTTGGATTGCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E421730] SGN-U277116 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T273867 [Download][View] Facility Assigned ID: STMEZ51TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.934 Expected Error Rate: 0.0057 Quality Trim Threshold: 20.5