Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E423022

Search information 
Request: 423022Match: SGN-E423022
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C274609Clone name: STM-41-K12
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C274609 [STM-41-K12] Trace: SGN-T275160 EST: SGN-E423023 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E423022Length: 357 bp (931 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E423022 [] (trimmed) TAATGACCTGATTATATTGAGAGTTCTTGCAATGTTTGCTGGCTTCTAAAATTGCAACTGCTTCTGCCATAGTACTTGTTGTATTTTCAATCCTG
GCACCATTTGCAAATATAATGTCTCCATTCTCATCTCTGAGACAGTAGGCATATGAACTCAATCCATAACATCCTTTAGCTGCACCATCTGTGTT
GTATTTGATCCATCCAGCCGGTGGGCTTTCCCATTTAACCTGAATGGCCTTAATTTTAGGCCTATATTCCTCTAGTTCCTTAAGCATTTTTGGCC
AGCTTCCTCCTCTCATGGTAGACCTGTTCACTTTAACAAACATATTCATGTGCCTGGTCACATTGTGAATTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E423022] SGN-U295806 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T275159 [Download][View] Facility Assigned ID: STMGF66TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0053 Quality Trim Threshold: 14.5