EST details — SGN-E425146

Search information 
Request: 425146Match: SGN-E425146
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C275713Clone name: STM-44-L1
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C275713 [STM-44-L1] Trace: SGN-T277284 EST: SGN-E425147 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E425146Length: 353 bp (1019 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E425146 [] (trimmed) ATTCTTTTGGATACAGATGTGGATACTGATGATTTCTTTGCTCTTTTCTACATTTTGAAGCTTAATAGATCAGAAATTGACTTGAAGGCTATAAC
TATTGGCACAAATGGATGGACTGATTCAGGACATGCTGTAAATCAAGTGTATGATATGCTTTACATGATGGGGCGCGACGATATTGCTGTTGGTA
TGGGAGGTGAAGGTGGAATACTTCCTAATGGTACCATTCTGCCTGATGTTGGTGGATATCCCCCTATAATTGATCAGGGATATGCTACAGCTGGA
TATTGTAGATATAGACAAGCTGGACCTGTTGGGCTTGGAGGACGCTTGGATATCGACTCAAATTATGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E425146] SGN-U289587 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T277283 [Download][View] Facility Assigned ID: STMGS61TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.945 Expected Error Rate: 0.0121 Quality Trim Threshold: 14.5