EST details — SGN-E427527

Search information 
Request: 427527Match: SGN-E427527
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C277061Clone name: STM-48-L1
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C277061 [STM-48-L1] Trace: SGN-T279663 EST: SGN-E427526 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E427527Length: 271 bp (1113 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E427527 [] (trimmed) TTTTTTTTTTTTTTAGAAATAGCATATATTATAATATGTACTATTTCTTATTTTCAGAATATGTACAATACACATCAGTATGATGTCGATTTGAA
CTATTGGCACATACTAACTAATGGAACATAATAAAAACAATATACATGTTGCAGTATCATATTTAGAAGAGACTGCAGTTTGCTTGTGCATAGTT
AATCTTCCTCATGAAATAAAGCACAGCATAGGGAGAGTTGTTCATTATATTGTCCCTATCATAAGCAAAAGTCACAAAATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E427527] SGN-U268162 Solanum tuberosum Build 4 54 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T279664 [Download][View] Facility Assigned ID: STMHI61TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.913 Expected Error Rate: 0.0133 Quality Trim Threshold: 20.5