Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E428135

Search information 
Request: 428135Match: SGN-E428135
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C277221Clone name: STM-49-D16
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E428135Length: 373 bp (927 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E428135 [] (trimmed) ATTTACCTTAATAAAAAAGTGTAATAATTTAGTTAAAGTTGGTAAAAATATTATATCTGTATAACTATGTCCTTAAGCCAACTATGTAGGCTTCT
GAATCACAAGAATTTTTTTTATAAAAAAAGTTACATTGATGAATTGAATTTAACATTGATGATGCTATACAAATGGAAAACAATCTCCTATTGAC
CATTGTCACTGTCACTGGCTCCAAGAGCATCTGCCAAATTGAAGGTCAGATTGCCTCTCATTGTTCTGGCTGCCAGTCCTGTATTTCCCTTCTTC
ATCATAGTTGCAAATTCCCCATAATCTATGCGTCCATCATTGTCTATGTCAATCTCTTTGATAATATCCTCCAATTTAACATCACCTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E428135] SGN-U291360 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T280272 [Download][View] Facility Assigned ID: STMHN20TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.926 Expected Error Rate: 0.0046 Quality Trim Threshold: 20.5