Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E430546

Search information 
Request: 430546Match: SGN-E430546
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C278627Clone name: STM-53-H24
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C278627 [STM-53-H24] Trace: SGN-T282682 EST: SGN-E430545 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E430546Length: 381 bp (917 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E430546 [] (trimmed) TTTTTTTTTTTTTTTTTAGCATAATACATTGCTTCTATATATAAATAAATTGTTGACTTCACAGACTCAGAACATGTCGAATTCGTGTTTAACTA
CAGACAAGGAAAAAGGAAAGTTATCAAAAGAAACGCAGGATATACACTCAACTGATTTACGCGAAGGTGATGCAAACTTGAGTTGATTTGACTTG
GTAGTGCCATGCTATACATAGTTATATCTATTTCTTCAGCCTCTTTTGAGCTGGGTCCAACTCTTCATCATTGTTTATATCCCGAAATTCCTCCA
TAAATTGATCGCCAGGTGCAGGTGGAGGATTTTCTGTATCCTTAGCATCCTTGTTTGCCCGCTTCCCTAGATTAATCTGCACTGATATACTGGCC
T
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E430546] SGN-U293939 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T282683 [Download][View] Facility Assigned ID: STMID48TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0051 Quality Trim Threshold: 20.5