EST details — SGN-E434011

Search information 
Request: 434011Match: SGN-E434011
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C280722Clone name: STM-59-G8
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E434011Length: 245 bp (844 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E434011 [] (trimmed) CGGGCCCCCCCTCGAGTTNTTAAAAACCAAAAAGGGGTTTTTTTTTTTTTTTACAACGAAAAAGAAATCCTTTTGAATTATCTAATATATAATAA
AAAAAAACCTCTATTACTCCAAATAACAGTATTTTGTCAAAAGGAAAGAAATAAAGATATGAAGAAAATTACAACCGATTAATACGACAAAATTT
AAATTTAAACTAGACTAATATAAAATATAAAATGAACCAACGAGGAAGGATATTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E434011] SGN-U274313 Solanum tuberosum Build 4 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T286148 [Download][View] Facility Assigned ID: STMIZ40TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.867 Expected Error Rate: 0.0221 Quality Trim Threshold: 14.5