EST details — SGN-E435110

Search information 
Request: 435110Match: SGN-E435110
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C281341Clone name: STM-61-C3
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C281341 [STM-61-C3] Trace: SGN-T287246 EST: SGN-E435109 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E435110Length: 362 bp (881 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E435110 [] (trimmed) AAATTGCATTTGAATTGAACTTGAGTAGAACAAATTGAGGTTACAAGTTACAACAGTAGGAAAGGGAGAACCGAGTAGTTATGAACTCTACTGAA
GAAATAATTCTAATGGGATGAATCGAAGAGTATATATTCTGTCTATATACAATTTTGAGCCAGAAGTATAACAAAATCTACAGATTTTTTTTTCC
TCATGATTCAGCTTGGTGAGTTTCTTTCTTTTGATGTAACTTAGGGTGGACCCTTGGATACAGCAGATCGTTTAATTGTCTTTCGGCACTGTACT
CCGAGGTTGCCCGCTTTTTAAAGGAAAACCGCAGTGTCTGAATTTGTGCTCCAGAGCAAACTCTTACGTCAAAACCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E435110] SGN-U298243 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T287247 [Download][View] Facility Assigned ID: STMJG14TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0055 Quality Trim Threshold: 20.5