Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E435181

Search information 
Request: 435181Match: SGN-E435181
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C281470Clone name: STM-61-I21
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E435181Length: 218 bp (892 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E435181 [] (trimmed) AACTAATAAAGGAGACTATTCAATCCTATAATCAGTGAATTGGCATTTTGTATCCAATCCAATTACATTCATCATAAGACTATTGCTAATTTCAC
CTATATCTTTCTTTTGCTACTGAACTTTCAAAAAGCTCAGATAAGGGATGACATACTGTTCTTCCAGCCAAAAGATCTCCTGCTCTTCCTCGGAG
GAGGTGTAATGCTAAGCCCAAACATCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E435181] SGN-U298806 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T287318 [Download][View] Facility Assigned ID: STMJG59TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.933 Expected Error Rate: 0.0052 Quality Trim Threshold: 20.5