Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E436047

Search information 
Request: 436047Match: SGN-E436047
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C281965Clone name: STM-62-O2
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C281965 [STM-62-O2] Trace: SGN-T288183 EST: SGN-E436046 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E436047Length: 557 bp (911 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E436047 [] (trimmed) GGGCCCCCCCTCGAGNTTTTTTTTCCTCTTTTTTTTTTTTTTTTTTTTTAGATAATAGATGATTCATATTACCAAACTAACAATACAATACAATA
TAATACGATACATTATGAGACAACCATTCAAACAGTGGGTAAAGGTTGCTATGTCTATAGCTAATTTATTATTTGCCACAAAACTAAAAATCAAC
TGTAACTTATTATGTATTTGACAACCATGGGCAAAAAGTGAAAAAACAGATGCATCCATTGATATTTGCCAGAACATCAACACTAACTTGCTAAT
TAATTTGTGCAACTCTCCAGTAACCTCTGGTATATTGCTAATTCATTCTAAGACCACGTCTTTGACGTCTCTTCTTTTGCCTTCTCCGCTTCTTA
GCAGCCAATTTGTTGAGCAATATCTTCAGCAAAGTTCACATACCATTTTGGTTTTTCCAGTAGAAACATGAGGCCTCCTATCAACAATCCAAATA
TCATACCACAACCATAACCTAGTACCACTGCTTCCCATGTGAACCCACTCATAAAAAATGAATCATCATCATCATCATCATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E436047] SGN-U291006 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T288184 [Download][View] Facility Assigned ID: STMJL85TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.933 Expected Error Rate: 0.0139 Quality Trim Threshold: 20.5