SGN ID: SGN-C208585 | Clone name: cSTA-19-G12 |  | Ordering Not Available |
|
Library Name: cSTA | Organism: Solanum tuberosum |
Tissue: Axillary buds of stemp explants; swelling stolons; growing stolons; growing sink-tubers
Development Stage: 1 to 3 days (plates 1-20), 4 to 6 days (plates 21-40), 7 to 10 days (plates 41-60)
There is no map position defined on SGN for this EST or others in the same unigene.
Sequence Id: SGN-E445932 | Length: 234 bp (904 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E445932 [] (trimmed)
GAGAGAGAGAGCAAAAAAATGGCATCTTACTTCAGAGTTTTTCTTTTCTTAGCCTTTTTTGCTGCTTCTTCCATAGCTCAATCTCCAGCTCCGGC
ACCAAAAATTTCTCCGGCAGCAACTCCAACTCCGGCGCCGGCACCGGTATTAGCTTCGCCGACCGCAACTCCAACTCCATCTTCAACTCCAACTC
CAACTCCGACTCCAACTCCGGCACCGTCTACCGCTCCCACTACT
[BLAST] [AA Translate]
SGN-ID: SGN-T210573 [Download][View] |
Facility Assigned ID: PSTCV42TH
|
Submitter: Koni |
Sequencing Facility: TIGR |
Funding Organization: National Science Foundation
Processed By: SGN |
Basecalling Software: phred |
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.935 |
Expected Error Rate: 0.0299 |
Quality Trim Threshold: 14.5 |