EST details — SGN-E447119

Search information 
Request: 447119Match: SGN-E447119
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C209944Clone name: cSTA-24-H23
nocartOrdering Not Available
Library Name: cSTAOrganism: Solanum tuberosum

Tissue: Axillary buds of stemp explants; swelling stolons; growing stolons; growing sink-tubers
Development Stage: 1 to 3 days (plates 1-20), 4 to 6 days (plates 21-40), 7 to 10 days (plates 41-60)

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E447119Length: 287 bp (1127 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E447119 [] (trimmed) TCTACTGAAGTTACTTCAGTCAATGAACACCGGTGCAAGAGTCACCGGCGACCACCGTACACCGTTGTTACAGGTGATTGGAATTGTACCGGCGC
TTTCGACTTCCGATTCCCTGTGGCCTCATAATGGATTTTTTGTTCAGCTTTCTGATTCTCTCAACTCTACTTATGTTTCCCTTTCGGAGCGTGAC
ACAGATCTCATCCTCACTAACCGGCTTCAGCTTGGTCAGTTTGTTCATGTTGACCGGATCTGTTTTGATTCTCCGCCTGTTCCACGGGCAGTCAA
TA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E447119] SGN-U294705 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T211760 [Download][View] Facility Assigned ID: PSTDQ48TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0123 Quality Trim Threshold: 20.5