Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E451160

Search information 
Request: 451160Match: SGN-E451160
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C238309Clone name: cSTS-11-N9
nocartOrdering Not Available
Library Name: cSTSOrganism: Solanum tuberosum

Tissue: sprouting eyes from tubers
Development Stage: 12-14 weeks post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E451160Length: 268 bp (939 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E451160 [] (trimmed) TTTTGCGTGGTATACTTCCCTGTCAGTAGCTGCATATATTGGTTTTACACTTTCTATCACACAGTGGAGGACTAAATTCAGGAAAGCCATGAATA
AGGCTGATAACGACGCTAGTACTAGGGCTATTGATTCACTTATTAATTATGAGACGGTCAAATACTTCAATAATGAAGTTCATGAAACTGATCAT
TATGACAAGTACCTAATGAGGTATGAGGATGCTGCTCAGAAAAGCGAACAGAGTCTTTCTTTGTTGAACTTTGGTCAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E451160] SGN-U297953 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T236736 [Download][View] Facility Assigned ID: PEYBQ77TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0028 Quality Trim Threshold: 20.5