EST details — SGN-E456154

Search information 
Request: 456154Match: SGN-E456154
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C243717Clone name: cSTS-28-P1
nocartOrdering Not Available
Library Name: cSTSOrganism: Solanum tuberosum

Tissue: sprouting eyes from tubers
Development Stage: 12-14 weeks post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E456154Length: 364 bp (935 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E456154 [] (trimmed) TCGACCCACTGTACCAAGAAAGTTTGATAAAGAACAAGGAGTTTACTTCAAAAAGAATGGGAAGAACAGTTATCTGCTTTGGGAATTGGATCCAA
CTCTAGCAATCAATCGAGCCCGAAGTAAGTCAAGGGGTCGTAAGCGAGAGAGATCTCTTTCCATGGCAAGATCAAGGTCAATGTCACACCTCGAA
GTGAATTTGTTCCAGGGGAGGGCTTCAAGGACAACCCCAGAAGAACGGCTATAAAGTTGTTAAGAAATCTGCTAATAAGAGGACAAGGATGCTCG
TCGGGGAGAGTCTGATAGAGTCATTCCTACTCTGAAACCAAAACATCTCTACTCTGGAAAGAGATCAAGTGGCAAAACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E456154] SGN-U287221 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T241730 [Download][View] Facility Assigned ID: PEYEG85TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.949 Expected Error Rate: 0.0148 Quality Trim Threshold: 20.5