EST details — SGN-E456775

Search information 
Request: 456775Match: SGN-E456775
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C244454Clone name: cSTS-30-D3
nocartOrdering Not Available
Library Name: cSTSOrganism: Solanum tuberosum

Tissue: sprouting eyes from tubers
Development Stage: 12-14 weeks post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E456775Length: 330 bp (1054 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E456775 [] (trimmed) GTAGTTCCAATTCAATGTTCATGATTTTTCAGATCTCTTCAGTCTTTTCTCTCCGATTCAGAAGATAAGATGATTGAACTCTCTCACATCCAATG
TGGACAATGTGCAAACCACATTGGATCAAAGTTCTGGGAAGTTGTATGTGATGAACATGGAATTGATCCTTCTGGACGCTATGTTGGAACATCAG
ATTTGCAATTGGAACGTGTCAATGTGTATTACAATGAAGCTTCATGTGGGAGGTTTGTTCCCCGTGCATTGCTCATGGATCTCGAGCCTTGCACC
ATGGACAGCGTGAGAACTGGTCCTTATGGCCATATATTTAGGCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E456775] SGN-U286781 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T242351 [Download][View] Facility Assigned ID: PEYEO14TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0321 Quality Trim Threshold: 14.5