EST details — SGN-E457135

Search information 
Request: 457135Match: SGN-E457135
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C246755Clone name: cPRO-1-D21
nocartOrdering Not Available
Library Name: cPROOrganism: Solanum tuberosum

Tissue: roots
Development Stage: in vitro grown stem cuttings

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E457135Length: 336 bp (989 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E457135 [] (trimmed) CAAAAAACGAGCAGAAGAGCATGGAGGCGGCGGCAGCAACGGCGGAATCTGTTCAATGCTTCGGGCGGAAGAAGACGGCTGTAGCAGTAACCCAC
TGCAAACGCGGTAAAGGTTTGATCAAGATCAACGGTGTACCTATCGAGCTAGTGCAACCAGAGATTCTCAGGTACAAGGCTTATGAACCTATTTT
ACTTTTAGGACGACACCGTTTTGCTGGTGTAGACATGAAGATCCGTGTGAAAGGTGGAAGGCACACCTCACCAATCTATGCCATTCCTCAGTCCA
TTGCCAAAGCACTTGGTGCATTTTAACAGAAATATGGTGATGAACAGTCCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E457135] SGN-U286777 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T242711 [Download][View] Facility Assigned ID: PROAC23TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.985 Expected Error Rate: 0.0224 Quality Trim Threshold: 12.5