Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E464762

Search information 
Request: 464762Match: SGN-E464762
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C249875Clone name: cPRO-19-C13
nocartOrdering Not Available
Library Name: cPROOrganism: Solanum tuberosum

Tissue: roots
Development Stage: in vitro grown stem cuttings

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E464762Length: 324 bp (916 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E464762 [] (trimmed) GCTACATGCCACCATACAATGGCTATGGGTATCAGACTCCTGGGGCATATGGGCTCATGCAGTATCGCCTACCATCAATGCAGAATCAGTCCGCA
TTTCAGAATATAGTCCCACCAATAAACCAAGCAAGTGCTCTACGTGGAGGTGCACCTGATCTTTCGCCTGGAATTAGCCCAAGAAATTATGCCAT
GTCACCTGGAAGTTATGGATCCGCTTAACCTGCTGTTCCAGGGATTCAGGATTCAATGCCATATCCTGGAGGTGTTATGAATGGCAGACCACCAA
GCGGTTCTCCTGGTTCAATTCCCCCTAGTACGACCAACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E464762] SGN-U291279 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T250338 [Download][View] Facility Assigned ID: PROCU19TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0221 Quality Trim Threshold: 14.5