Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E467244

Search information 
Request: 467244Match: SGN-E467244
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C224942Clone name: cSTB-44-A19
nocartOrdering Not Available
Library Name: cSTBOrganism: Solanum tuberosum

Tissue: leaves and petioles
Development Stage: 8 weeks old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E467244Length: 312 bp (920 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E467244 [] (trimmed) TTTATAGCTACGGAATGGTGCGGTTGGATATGATTGGAGGGAGGAGAACACTTACTTTAGCTGAAAATGGAAAGAGTACCAATTCAAAGAGTAAG
TTCAGCTATTTTCCTAAGATTGTGAGTGAGAAATTGGAGCAGGGGAAGATCATGGAAGTCCTGGACGAGAGGCTCGTCCACGAGGCAGCTACAGG
TGGTGTAGCTGTAGAAATGCAAGTGAAAAGATTGGCGTGCGTGGCGTTGTCTTGCATCCAAGAACGGCCTAGTCTTAGGCCAACAATGGCACGAG
TCGTGGAAATGTTGGAAGGTCGTGGGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E467244] SGN-U296701 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T212465 [Download][View] Facility Assigned ID: PSHGQ10TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0105 Quality Trim Threshold: 20.5