EST details — SGN-E471267

Search information 
Request: 471267Match: SGN-E471267
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C219539Clone name: cSTB-23-K16
nocartOrdering Not Available
Library Name: cSTBOrganism: Solanum tuberosum

Tissue: leaves and petioles
Development Stage: 8 weeks old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E471267Length: 285 bp (952 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E471267 [] (trimmed) AGACAGTTACATAAAGCTGATGTTTCATCCCATGGTATGGATGATGTTCAACTTTCACTTGGGCATGCACATTCCCAGTCAGAGGGGAACATGCT
GAGCCAAATACCATTTTATTTTCCAAATGTTCAAAATACTTCGCACAAATTACTTCACCTGGCTACTACAAATGTAGGGACCTTAGATTCTCTCT
GTCTCAGGGGAAAACACACAAGAGCTAGATTCAATCAATCCGAGAACTCTGCAGGTTCAGGTGTTGAATGTTCATTCAGTTCTCGAATTATGAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E471267] SGN-U281003 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T216488 [Download][View] Facility Assigned ID: PSHDL68TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0122 Quality Trim Threshold: 14.5